Come trovo il palindromo più lungo in una stringa?


33

La sfida:

Crea una funzione che trova il palindromo più lungo all'interno di una stringa.

Nota: questa è una domanda di . Si prega di non prendere sul serio la domanda e / o le risposte. Maggiori informazioni qui .


7
Se non potevi dirlo, questo è un altro problema di pesca a traina, sebbene con meno spiegazioni rispetto all'ultimo.
Joe Z.

19
Purtroppo, "una stringa" non ha affatto palindromi.
Mark Reed il

17
Quindi code-trollingè il mio nuovo tag preferito.

4
Abbiamo due domande di code trolling nell'elenco Domande sulla rete calda ora!
Joe Z.

18
Hmmm. Mentre la prima domanda [trolling di codice] era divertente, non posso fare a meno di pensare che queste domande ridurranno davvero la qualità di questo sito se voi ragazzi non state attenti. Queste domande sono facili da rispondere e alle quali non è facile rispondere e posso vederle invecchiare molto, molto velocemente. Solo i miei 2 centesimi.
Reid,

Risposte:


19

Partire

La seguente soluzione in Go utilizza i poteri nascosti di concorrenza, chiusure e ricorsività per trovare il palindromo più lungo all'interno di una determinata stringa:

func lp(s string) string {
    for i, l := 0, len(s); i < l; i++ {
        if s[i] != s[l-i-1] {
            a, b := make(chan string), make(chan string)
            go func() {
                a <- lp(s[:l-1])
            }()
            go func() {
                b <- lp(s[1:])
            }()
            c, d := <-a, <-b
            if len(c) > len(d) {
                return c
            }
            return d
        }

    }
    return s
}

Inoltre, si basa interamente su primitive di linguaggio e tipi integrati - nessuna libreria standard - è così che riconosci un software di qualità reale.

Potresti voler alzare un po 'i limiti di thread, memoria e dimensioni dello stack per stringhe di input più grandi - questo perché questa soluzione è così veloce che il tuo sistema operativo diventerà geloso.

Modifica - Vantaggi:

  • totalmente inutile su stringhe di caratteri multibyte.
  • non ometterà la punteggiatura o i caratteri di spazi bianchi.
  • omette l'uguaglianza maiuscola / minuscola.
  • funziona in un tempo difficile da calcolare, anche se molto lento.
  • genera un sacco di goroutine, a seconda dell'input.
  • viene ucciso per esaurimento della memoria dopo un paio di secondi sulla mia macchina con oltre 16000 2049186 goroutine generate per l'input"345345ABCDEabcde edcbaDEABC12312123"

45

Pitone

def longest_palindrome(s):
    return 'racecar'

Esempio di utilizzo:

>>> print longest_palindrome('I like racecars!')
racecar

Nota: questo può funzionare solo per determinate stringhe.


21
L'ho provato con "abcdedcba" ma è appena tornato "racecar" ... cosa sto facendo di sbagliato?
Joe Z.

22
@JoeZ. Stai usando la stringa sbagliata. Provalo con 'abcde racecar'.
grc,

10
Ok, ma ora lo sto provando con "abcde racecar edcba" e restituisce solo "racecar" anche se è disponibile un palindrome molto più grande.
Joe Z.

63
@JoeZ. Hmm ... Probabilmente un problema unicode.
grc,

11
@JoeZ. Probabilmente dovresti comprare un nuovo computer.
emory,

13

Chiaramente, controllare Palindromes è difficile.

Quindi la soluzione è piuttosto semplice: genera un insieme di ogni singolo Palindrome grande quanto la stringa che stai testando e vedi se la stringa lo contiene.

C #

string largest = String.Empty;

    for(int i=0; i < myString.lenght; i++)
    {

//Don't use the newfangled stringbuilder. Strings are awesome
char[] testString = new char[i];

    for (int charPosition=0; charPosition < i/2; charPosition++)
    {
    for (char c = 'A'; c <= 'Z'; c++)
    {
       if ((charPosition/i) == i/2)
{
//middle one
testString[i] = c;
} 
else 
{
//do one for that position, and the lenght-position
testString[i] = c;
testString[testString.length - i] = c;
}

if (myString.Contains(testString.ToString())
{
//yaay
largest = testString.ToString();
}


{

}
    } 

}


}

(Potrei aver bisogno di controllare la correttezza del mio codice, ma per il resto è un modo meravigliosamente orribilmente inefficiente per verificare la presenza di Palindromi)


Ovviamente non eseguiranno mai i programmi su stringhe lunghe perché sono così difficili da calcolare. Quindi va bene. È possibile ridimensionarlo eseguendolo su un VPS migliore o in un data center, se lo si esegue in un ambiente aziendale. Per i compiti dovrebbe andare bene con solo 3-4 stringhe di caratteri.
Emil Vikström,

12

Perl

Fa tutto quanto richiesto. In realtà è meglio, perché tiene conto di ogni possibile sottosequenza . Qual è il trucco? Funziona in tempo esponenziale, quindi ogni carattere aggiuntivo nella stringa raddoppia il tempo di esecuzione. Dagli più di 20 personaggi e ci vorrà tutto il giorno.

$inputstring = <>;
@arrayofcharacters = split("",$inputstring);
for(0..2**length($inputstring)-1){
 $currentsubsequence = "";
 @choice=split("",sprintf("%b",$_));
 for(0..$#arrayofcharacters){
  $currentsubsequence .= "$arrayofcharacters[$_]" x $choice[$_];
  if($currentsubsequence eq reverse($currentsubsequence)){
   $palindromes{length($currentsubsequence)} = $currentsubsequence;
   $palindromes[~~@palindromes] = length($currentsubsequence);
  }
 }
}
print($palindromes{@{[sort(@palindromes)]}[$#palindromes]})

Ingresso: iybutrvubiuynug. Uscita: ibutubi.

Ingresso: abcdefghijklmnopqrstuvwxyzzyxwvutsrqponmlkjihgfedcba. Uscita: non accadrà


Questa è letteralmente la mia risposta, ma in Perl. Inoltre, non monekmized. modifica: nvm, il mio è più efficiente

Ho pubblicato la mia risposta prima della tua, quindi non si sta copiando.
PhiNotPi,

2
Ho avuto l'idea per prima! Ho solo impiegato più tempo per scriverlo (ho dovuto pensare alle battute C e scimmia. Inoltre, l'ottimizzazione vale il tempo di sviluppo aggiuntivo)

6
Va bene. Sono orgoglioso della mia inefficienza.
PhiNotPi,

10

Il tuo problema è facilmente risolto dalle espressioni regolari, proprio come nella foto qui sotto (ma ho deciso di usare java invece). Ciò accade perché regex è sempre lo strumento migliore che può essere utilizzato per tutto ciò che comporta l'estrazione o l'analisi del testo.

Conosco un'espressione regolare

package palindrome;

import java.util.regex.Pattern;
import javax.swing.JOptionPane;

public class RegexPalindrome {

    private static String next(String now) {
        if (now.isEmpty()) return "a";
        String prefix =  now.length() == 1 ? "" : now.substring(0, now.length() - 1);
        if (now.endsWith("z")) return next(prefix) + "a";
        return prefix + String.valueOf((char) (now.charAt(now.length() - 1) + 1));
    }

    public static void main(String[] args) {
        String text = JOptionPane.showInputDialog(null, "Type some text:");

        String bestPalindromeFound = "";

        for (String searchText = "a"; searchText.length() <= (text.length() + 1) / 2; searchText = next(searchText)) {
            String reverse = new StringBuilder(searchText).reverse().toString();
            if (searchText.length() * 2 - 1 > bestPalindromeFound.length()) {
                Pattern p = Pattern.compile(".*" + searchText + reverse.substring(1) + ".*");
                if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse.substring(1);
            }
            if (searchText.length() * 2 > bestPalindromeFound.length()) {
                Pattern p = Pattern.compile(".*" + searchText + reverse + ".*");
                if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse;
            }
        }
        JOptionPane.showMessageDialog(null, "The longest palindrome is \"" + bestPalindromeFound + "\".");
    }
}

Questo codice è male perché:

  • Funziona in tempo esponenziale fino alla dimensione del testo dato. Funziona enumerando tutte le stringhe nella forma az, creando due regex per ogni stringa generata e testando l'input su ogni regex.
  • Inoltre, fallisce se il palindromo contiene lettere maiuscole, numeri, testo non ascii, punteggiatura, ecc.
  • E, naturalmente, regex non è chiaramente lo strumento giusto per questo.

E, naturalmente, le parti della GUI sono lì solo per distrarre:>
Emil Vikström,

@ EmilVikström Sì, un effetto collaterale del code-trolling è che possiamo felicemente sovvertire il modello MVC. Inoltre, un OP pigro probabilmente non sa cosa sia MVC e sarebbe molto più colpito da un programma che ha tutta la GUI accoppiata in esso e pensa che sia più bello e avanzato di quei vecchi noiosi prompt / console / DOS windows (ma il suo insegnante potrebbe non pensarlo). OTOH, se all'OP pigro non piace la GUI accoppiata, beh, è ​​bello, l'obiettivo era comunque frustrarlo.
Victor Stafusa,

Anche il preludio è errato. Tecnicamente parlando, i palindromi non fanno parte della classe delle grammatiche regolari e quindi non sono riconoscibili dalle espressioni regolari. Fortunatamente abbiamo PCRE che include la classe di grammatiche sensibili al contesto.
recursion.ninja,

7

Pitone

Questo prende la stringa e la riorganizza nel palindromo più lungo possibile disponibile.

Per esempio:

Input: Ciao

Uscita: lol

def get_palindrome(string):
    if len(string) == 0:
        return "I didn't catch that"
    list_of_characters = []
    occurances = []
    for character in string:
        if not character in list_of_characters:
            list_of_characters.append(character)
            occurances.append(1)
        else :
            occurances[list_of_characters.index(character)] +=1
    #check if a palindrome is possible
    if sum(occurances) == len(occurances): #no double letters, so only a one character palindrome
        return list_of_characters[0]
    first_half = ''
    second_half = ''
    middle_character = ''
    for index, character in enumerate(list_of_characters):
        number_of_occurances = occurances[index]/2
        first_half += character * number_of_occurances
        second_half = (character * number_of_occurances)+ second_half
        if (occurances[index]%2 != 0):#if there are an odd number, there will be one spare,
            #so put it in the middle
            middle_character = character
    return first_half + middle_character + second_half


print(get_palindrome(raw_input("String containing palindrome:")))

3
In realtà è piuttosto sfacciato XD
Sean Allred il

7

interpretazione bioinformatica

Domanda molto interessante amico!

I palindromi in linguaggio normale non sono completamente chiaramente specificati, ad esempio se gli spazi sono consentiti o meno. Quindi non è chiaro se questi dovrebbero essere ammessi come palindromi o meno:

  • Le oche vedono Dio?
  • Un uomo, un piano, un canale - Panama!

Ad ogni modo, penso che ti riferisci al significato scientifico meglio specificato di palindromo: affinché una sequenza nucleotidica sia considerata come un palindromo, il suo filo complementare deve leggere lo stesso nella direzione opposta. Entrambi i fili, vale a dire il filo che va da 5 "a 3" e il suo filo complementare da 3 "a 5", devono essere complementari (vedi qui ).

Sono state fatte alcune ricerche per il riconoscimento della sequenza del palindromo e penso che dovresti davvero leggere almeno questo . Per risolvere il tuo problema, puoi semplicemente copiare il loro approccio! Il professore invia anche il codice sorgente se glielo chiedi.

Bene, ora al problema attuale. Supponiamo di avere una sequenza nucleotidica data come stringa di caratteri. Il modo migliore per trovare i palindromi in una tale sequenza è utilizzare algoritmi standard. Penso che la tua scommessa migliore stia probabilmente usando questo strumento online: http://www.alagu-molbio.net/palin.html

Dato che ti viene richiesto di fornire una funzione che svolge l'attività, devi pensare a come inserire la tua stringa in questa app? Bene, lì inizia il divertimento. Penso che potresti usare il selenio per quello. Dal momento che non voglio fare i compiti, ti do solo l'idea di base. In Java il tuo mondo inizia così:

package testing;

import java.util.regex.Matcher;
import java.util.regex.Pattern;

import org.openqa.selenium.By;
import org.openqa.selenium.WebDriver;
import org.openqa.selenium.WebElement;
import org.openqa.selenium.phantomjs.PhantomJSDriver;

public class PalindromeService {


    public static void main(String[] args) {
        WebDriver d1 = new PhantomJSDriver();

        d1.get("http://www.alagu-molbio.net/palin.html");

        String sequence = "AAGTCTCGCGAGATCTCGCGAGATCTCGCGAGATCTCGCGAGAAA";

        WebElement txtArea = d1.findElement(By.tagName("textarea"));

        txtArea.sendKeys(sequence);

        WebElement send = d1.findElement(By.cssSelector("input[type=submit]"));
        send.click();

        String result = d1.findElement(By.tagName("body")).getText();

        Pattern p = Pattern.compile(".*capitalized\\.[^agctACGT]*([agctACGT]+).*");
        Matcher m = p.matcher(result);
        if (m.find()){
            result = m.group(1);
        }

        //now you have all palindromes in upper case! 
        //I think you can take it from here, right?

        System.out.println(result);

        d1.quit();
    }
}

Se sei interessato ai palindromi linguistici puoi utilizzare la stessa tecnica con altri servizi web come http://www.jimsabo.com/palindrome.html o http://calculator.tutorvista.com/math/492/palindrome-checker .html

tecniche di code trolling

  • omettere le fonti veramente utili come http://rosettacode.org/wiki/Palindrome_detection

  • bla interessante ma inutile sulla bioinformatica

  • deliberatamente fraintendere questo come compito bioinformatico

  • barare - per risolvere il problema viene utilizzato un servizio web


6

Pitone

def get_substrings(a_string):
    """Get all possible substrings, including single character substrings"""
    for start_index in range(len(a_string)):
        for end_index in range(start_index + 1, len(a_string) + 1):
            yield a_string[start_index:end_index]

def get_longest_palindrome(a_string):
    """Find the longest palindrome in a string and return its index or -1"""

    # Initialise variables
    longest_palindrome = get_longest_palindrome.__doc__[5:27]
    palindromes_list = []

    # Search string for all palindromes
    for substring in get_substrings(a_string):
        if reversed(substring) == substring:
            palindromes_list.append(substring)

    # There should always be palindromes in non-empty strings (single characters),
    # but it's good practice to check anyway
    if len(palindromes_list) > 0:
        longest_palindrome = max(palindromes_list, key=len)

    return a_string.find(longest_palindrome)

La stringa "il palindromo più lungo" viene estratta dal docstring in longest_palindrome.

La reversed()funzione restituisce un iteratore, quindi reversed(substring) == substringnon sarà mai vera e longest_palindromenon verrà mai sovrascritta.

Quindi, la funzione troverà letteralmente "il palindromo più lungo" all'interno di una stringa.


Ma "il palindromo più lungo" non è nemmeno un palindromo ... e qualcun altro ha già pubblicato questo.
Joe Z.

4
Il problema con soluzioni come queste è che sono troppo evidenti. Anche un programmatore principiante saprebbe che li stai guidando.
Joe Z.

1
@JoeZ. Ho aggiunto una versione molto meno ovvia.
grc,

1
La tua versione meno ovvia colpisce il segno. Sarebbe bello se hai rimosso la versione ovvia, però.
Joe Z.

5

Javascript

Oh, è facile;). Ecco qui:

function () {
    var palidrome = "Star? Not I! Movie – it too has a star in or a cameo who wore mask – cast are livewires.

Soda-pop straws are sold, as part-encased a hot tin, I saw it in mad dog I met. Is dog rosy? Tie-dye booths in rocks.

All ewes lessen ill. I see sheep in Syria? He, not I, deep in Syria, has done. No one radio drew old one.

Many moths – I fondle his; no lemons are sold. Loot delis, yob, moths in a deli bundle his tin. Pins to net a ball I won – pins burst input. I loot to get a looter a spot paler. Arm a damsel – doom a dam. Not a base camera was in a frost, first on knees on top spot. Now a camera was a widened dam.

Ask: Cold, do we dye? No, hot – push tap, set on to hosepipe. Nuts in a pod liven.

A chasm regrets a motto of a fine veto of wars. Too bad – I all won. A sadist sent cadets – a war reign a hero derides. A bad loser, a seer, tossed a cradle – he begat to cosset – a minaret for Carole, Beryl, Nora. We’re not as poor to self.

I risk cold as main is tidal. As not one to delay burden, I don’t set it on “hot”. A foot made free pie race losses runnier. As draw won pull, eye won nose. Vile hero saw order it was in – even a moron saw it – no, witnessed it: Llama drops – ark riots. Evil P.M. in a sorer opus enacts all laws but worst arose. Grab a nosey llama – nil lesser good, same nicer omen.

In pins? No, it is open. If a top spins, dip in soot.

Madam, as I desire, dictates: Pull aside, damsels, I set a rag not for a state bastion. A test I won e.g. a contest I won.

Kidnap, in part, an idle hero. Megastars, red, rosy, tied no tie. Blast! A hero! We do risk a yeti’s opposition!

He too has a wee bagel still up to here held.

Demigods pack no mask, cap nor a bonnet, for at last a case is open – I left a tip – it wets. A dog wets too. Radios to help pay my tip, pull a tip.

Ale, zoo beer, frets yon animal. Can it? New sex arose but, we sots, not to panic – it’s ale – did I barrel? Did I lose diadem, rare carrot in a jar of mine? Droop as tops sag – unseen knots.

A cat ate straw as buck risk cud; evil foe, nil a red nag ate? Bah! Plan it – silage. Model foot in arboreta.

I, dark Satanist, set fire – voodoo – to slat. I design a metal as parrot, I deem it now. One vast sum is no ten in set – amen! Indeed, nine drag a yam, nine drag a tie. Dame nabs flower; can we help man? Woman is worse nob.

Mud level rose, so refill a rut. A nag of iron I made to trot I defied – I risk leg and its ulnae. Can a pen I felt to bid dollar or recite open a crate, open a cradle, his garret?

Sample hot Edam in a pan. I’m a rotten digger – often garden I plan, I agreed; All agreed? Aye, bore ensign; I’d a veto – I did lose us site. Wool to hem us? No, cotton. Site pen in acacias or petals a last angel bee frets in.

I met a gorilla (simian); a mate got top snug Noel fire-lit role. Manet, Pagnol, both girdle his reed bogs.

Flan I reviled, a vet nods to order it, Bob, and assign it. Totem users go help mates pull as eye meets eye. Son – mine – pots a free pie, yes? No. Left a tip? Order a dish to get. A ring is worn – it is gold. Log no Latin in a monsignor, wet or wise. Many a menu to note carrot.

Cat in a boot loots; As I live, do not tell! A bare pussy, as flat on fire, I know loots guns, fires a baton, nets a hero my ale drop made too lax.

If it is to rain, a man is a sign; I wore macs, no melons rot. I use moths if rats relive, sir, or retire.

Vendor pays: I admire vendee, his pots net roe. Nine dames order an opal fan; I’ll ask cold log fire vendor to log igloo frost. Under Flat Six exist no devils.

Marxist nods to Lenin. To Lenin I say: “Mama is a deb, besides a bad dosser.”

Gen it up to get “ova” for “egg”. I recall a tarot code: yell at a dessert side-dish sale. Yes/nos a task cartel put correlate: E.S.P. rocks a man. I am a man, am no cad, I’m aware where it’s at!

Fire! Its an ogre-god to help, man, as I go. Do not swap; draw, pull a troll!

It’s not a cat I milk – calf, for a fee, sews a button – knit or tie damsel over us. Mined gold lode I fill until red nudes I met in a moor-top bar can. I sit, I fill a diary – trap nine men in ten-part net – oh, sir, I ask, cod nose? No, damp eel.

So, to get a name! I say, Al! I am Al! Last, I felt, to breed, deer begat.

To can I tie tissue – damp – or deliver Omani artist – a man of Islam.

In a den mad dogs lived on minis a signor who lived afore targets in at. As eremites pull, I, we, surf, fantasise, mend a bad eye. No hero met satyr; Tony, as I stressed, won’t, so cosset satyr.

A vet on isles made us sign it, a name. Foe man one sub.

Aside no dell I fret a wallaby; metal ferrets yodel, like so. On a wall I ate rye. Bored? No, was I rapt! One more calf? O.K., calf, one more, bossy! No! Lock cabin, rob yam, sip martini. Megastar was in a risk.

Cat? No, I’m a dog; I’m a sad loyal pet. A design I wore – kilts (a clan); if net drawn, I put it up. Royal spots snag – royal prevents rift.

Composer, good diet, are both super, God – label it a love of art, lustre. Video bored, no wise tale e.g. a mini tale – no sagas seen. Knack: cede no foes a canal.

Pay – as I sign I lie; clear sin it is; e.g. “Amadeus” sign I – lira for ecu, decimal – sin as liar.

Trad artistes pull a doom, a drawer won’t.

Is it sold loot? No, I suffered loss. A man is god; Amen! I came nice Tahiti (sic).

It’s ale for a ban if for a fast – is role to help mash turnip? Use zoo? No – grasp order – use no zoos. Warts on time did sag.

No grade “X” “A” Level? Oh, “A”! I’d a “B” or a “C”. So – pot? No, we lop. Date? Take no date! Bah! Play L.P.

Miss (a lass, all right?) flew to space in NASA era. Rose no (zero) cadets ate raw. As a wise tart I fined rags red Lenin, we help pay bet – a risk – cash to Brian. I put a clam in a pool – a pool wets.

Mahdi puts a stop to harem – miss it in one vote, lost in one, veto of none. Post-op, no tonsil; I ate; no tastier, eh? We sleep at noon time so I dare not at one; no time stops as I time tides. A bed: under it, roll; in a mania, panic!

In a pond I did as Eros as Lee felt tenrec. “Ink” – list it under “I”. Termites put pen in a way. Democrats wonder, I too. To slay moths a dog did.

I saw elf; elf, far now, is a devilish taboo, rag-naked. I hid a bootleg disc. I, saboteur, toss it in. Oops! No legs! Laminated, a cask, conker in it, negates all if it is simple.

Hot pages are in a mag, nor will I peer, familiar tat, so lewd, native rot. Toner, ewe wore no trace; vagabond ewes do. Oh, Ada! Have pity! A pitiable eel – “Oh wet am I!” – to save, note: bite gill as I do.

Call a matador minor, eh? As I live, don’t! Is torero no rigid animal debaser if tipsy? Ale drew esteem in a matador. A bolero, monks I rate play or go dig rocks; a can I step on.

Go! Gas – it evades a bedsit – set a roost on fire. Boss sent a faded eclair to green imp or dog, I’d don a belt to boot it; if Ada hid a boot, panic.

I mock comic in a mask, comedian is a wit if for eventide. Vole no emu loved is not a ferret, so pet or witness a weasel if not. I hired less, am not so bossy, as yet amateur.

To stir evil, Edna can impugn a hotel: bad loos, hot on Elba: I may melt. Tart solicits it rawer, gets it rare. Push crate open; I ram buses, use no trams.

Did I say, not to idiot nor a bare ferret, to trap rat, strap loops rat? Stewpot was on. Hot? I was red! Lessen it! Fine man on pot? No, pen inside by a bad law. So I made rips – nine delays.

Some Roman items in a.m. ordered “Is room for a ban?” “It is,” I voted: I sat pews in aisle. Beryl, no tiro to my burden, made off for a contest, I won kiss. I may raid fine dales. I raid lochs if I to help am.

Forecast for Clare v. Essex: If no rain, a man is ref. Fusspots net foxes.

Senor is a gnome, latinos’ bad eyesore. Help misses run to border, Casanova, now, or drab hotel.

Ma has a heron; I sleep, pet’s on nose, sir! Rev. I rag loved art live – fine poser. Ultra-plan: I feign, I lie: cedar to disperse – last one? No, last six. Enamel bonnet for a dark car to toss a snail at. In it all, Eve lost; Seth’s a hero slain on a trap – Rise, Sir Ogre Tamer.

Upon Siamese box I draw design. I, knight able to help, missed an alp seen in Tangier of fine metal pots. Tin I mined rages – order nine, melt ten. Tone radios; tones are not to concur. Ten-tone radar I bomb – best fire-lit so hostel side meets eerie mini red domicile. A gulf to get is not a rare tale; no time to nod.

Row on, evil yobs, tug, pull. If dogs drowse, fill a rut. An era’s drawers draw. Put in mid-field in a band I dig a tub deep. Staff on a remit did refill a minaret.

Sam’s a name held in a flat, or, sir, bedsit. I wonder, is it illicit ore? No ties? A bit under? Retarded? Is ‘owt amiss? I’m on pot; not so Cecil, a posh guy a hero met. A red date was not to last so Cecil sat.

Tip? An iota to pay, a dot; sad, I drop item. I’d ask, call, Odin, a Norseman’s god: “Pay payee we owe radio dosh o.n.o.” I to me? No, I to media.

Peril in golf – is ball a “fore”? K.O.!

Vexed I am re my raw desires. Alto has eye on nose but tone-muser pianist is level-eyed. I lost a tie. Blast! In uni no grades are musts. Avast! Never port! Sea may be rut.

Part on rose? – It’s a petal. Define metal:

Tin is . (I gulp!) can!

I am a fine posse man, I pull a ton. Ron, a man I put on, I made suffer of evil emu’s sadism. Leo’s never a baron – a bad loss but evil – topple him, Leo’s lad. Assign a pen, can I? A pal is note decoding.

Is damp mule tail-less? No, ill; I breed for its tone. Radio speed, to grower, grew. Open a lot? No, stamp it; if for a free peso – not ecu -deign it. Times ago stone rates, e.g. at Scilly, display a wont.

No wish to get a design I, Sir Des, I’ve let? No bus sees Xmas fir. O.K. – cab – tart it up; tie lots – diamond, log or tinsel; first end errata edit. So “le vin (A.C.)”, Martini, Pils lager, one tonic.

I pegged a ball up to here when I got a top star role, Beryl. Gun is too big – won’t I menace? Yes? No?

Ill? A cold? Abet icecap’s nip. U.S.A. meets E.E.C. inside tacit sale – see! Beg a cotton tie, ma! No trial, so dodo traps exist. Arabs under-admire card label good hood stole.

In rage erupted Etna. Will a rotunda, bare villa, to tyro. Lack car? Non-U! Get a mini! My, my, Ella, more drums per gong; get a frog – nil less. Rod, never ever sneer. Got to?

I disperse last pair of devils (ah!) here today or else order cash to breed emus. Said I: “Are both superlative?” C.I.D. assign it lemon peel still. I wore halo of one bottle from a ref (football) – a tip; so hit last ego slap a mate got.

Late p.m. I saw gnu here (non-a.m.) or an idea got a dog to nod – I made felt to boot.

Fill in a lad? Nay, not all, Edna – lash to buoy. Did you biff one Venus? Not I! “Broth, girl!” ladies ordered – “No, with gin!” – a fine plate, maybe suet; no carton I made rots in it.

Med: a hill, Etna, clears in it. Ali, Emir, to slap in/slam in. All in all I made bad losers sign it – alibi. Set a lap for a level bat.

A bed, sir, eh? To put cat now? Drat! Such an idyll of a dog’s lair! That`s it, open it – a cage! Big nit sent rat! Some day (A.D.) send ewe. No, draw a pot now, do! Of wary rat in a six ton tub.

Edna, ask satyr: “Tel. a.m.?” No, tel. p.m.; Israeli tuner is damp. Use item: “Anna Regina”. No! Dye main room (“salle”) red!

Nice caps for a sea cadet in U.S.A. – Now I, space cadet, am it, sea vessel rep. Pin it on Maria, help Maria fondle her fine hotpot. No! Meet; set up to net, avoid a lesion. Set acid arena: Bruno one, Reg nil. Like it to sign in? Even I am nine-toed! I vote votes.

Oh, can a nose-rut annoy? No, best is Dorset. I know, as liar, to snoop, malign. “I’ll order it to get a bedroom door,” began a miser I fed.

Am I to peer, fan? Is a door by metal? Ere sun-up, drowse, nod, lose magnet. Food? Buns? I’ll ask. Corn? I’ll ask. Corn – I snack. Cats snack (cold rat). Sum for a bag: nil. First, is remit “traps in net”? Yes, on a par. Coots yell over a dam I made. Bared nudist went a foot, I made roots. I tip a canon: “Row, sir, at same tide; man one: row tug.”

Sewer of denim axes a wide tail – a terror recipe to hero made manic. I, to resign? I ? Never!

“OFT I FELT ITS SENSUOUSNESS” – title fit for evening is erotic; I named a more hot epic – error retaliated – I was examined for ewe’s gut, wore no named item.

A star is worn on a cap, it is too red. Am I too fat? Newts I’d under a bed. Am I mad? Are volleys too crap? A nosey tennis part-timer sits rifling a bar of mustard.

Lock cans, stack cans in rocks, all in rocks, all I snub. Do often games, old ones, word-pun use; relate, my brood, as in a free pot I made fires, I manage brood. Moor debate got tired rolling, I lampoon, so trail saw on kites.

Rod sits, ebony on nature, so Nana chose to veto video. Ten in main evening is O.T.T. i.e. killing; Ere noon, urban eradicates noise, lad, I ovate not. Put esteem on top (to hen, if reheld).

No fair ample hair – am not I nipper-less? Eva estimated ace caps I won as united. A Caesar of space, Cinderella’s moor, Niamey Don (a Niger-an name), ties up mad sire, nut! I, Lear, simpleton male, try tasks “A” and “E”

but not “XI”. Sanitary raw food won top award one Wednesday – a demo.

Start nesting, I beg a cat. I? Nepotist? Ah, trials, God! A folly, Dinah, custard won’t act up; other is debatable. Velar: of palate; sibilating is “s”.

Resold: a bed, a mill, an ill animal – snip, also trim. Eilat in Israel can tell I had ‘em. Tin I stored (am I not raconteuse?) by a metal pen. If a night, I wondered, rose, I’d all right orbit on sun, even off.

I buoy, did you? Both Sal and Ella, Tony and Alan (“Ill if too bottle-fed, am I?”) do not. God! A toga! Ed in a Roman one, rehung! Was I, M.P. et al., to get a map? Also get salt? I, hospital lab to offer, am, or felt to be, no fool – a hero.

Will it sleep? No, melting is sad ice. Vital re-push to be raid, I assume. Deer, both sacred roes, Leroy (a doter, eh?) has lived for. I, apt sales rep’s idiot to greens, revere vendors selling or fat egg-nog reps.

Murder O’Malley, my mini mate – gun on rack. Calory total: liver, a bad nut or all I wanted (“et puree garnie”): lots. “Do, oh do, ogle bald racer,” I’m dared – N.U.S. bar at six.

Esparto, dodo’s lair to name it, not to cage bees, elasticated, is nice. Esteem, as up in space, cite bad local lions, eye can emit now. G.I. boots in ugly rebel or rat’s potato gin (eh?) were hot. Pull a bad egg – epic, I note, no regal slip in it. Ram can . (I’ve lost idea!)

Tarred nets, rifles, nitro, gold – no maid stole it. Put it, rat, back or if Sam (“X”) sees sub on televised rising, I sedate Goths. I won’t – no way.

Alps, idyllic stage set, are not so gas-emitting, I educe. To nose, peer, far off, I tip mats onto lane. Power grew or got deep so I dare not stir. Of deer, billions sell. I ate lump – mad sign, I do cede – tonsil a pain, acne pang is sad also. Elm I help pot, live – tub’s sold; a ban or a bar, even so, elms, I’d assume, live for. Effused am I not, up in a manor, not all up in a mess.

Open if a main A.C. plug is in it.

Late men I fed late – pasties or not. “Rapture” by a maestro prevents a vast sum erased.

Argon in units, albeit at solid eye level, sits in a . (I presume not) . tube, son. No eyes: a hot laser – is Ed wary?

Mermaid, ex- evoker of all A.B.s, I flog. Nil I repaid. Emotion! Emotion, oh so do I dare, woe!

Wee yap-yap dog’s name’s Ron. An idol lacks a dime tip, or did, as today a potato in a pitta slice costs a lot – tons. A wet adder ate more hay. Ugh! So, pal, ice cost on top? No, miss, I’m a two-sided rat, erred nut, I base it on erotic ill; It is I, red now; it is debris, rot.

Alf, an idle he-man as “master animal lifer” did time, ran off at speed, but a G.I. did nab an idle if dim nit. Upwards rewards are natural life’s words, God. Fill up guts, boy, live now or do not emit one later. A rat on site got flu.

Gaelic, I’m odd Erin, I’m Eire, esteemed islet. So hostile rifts ebb. Mob, I.R.A., dare not net R.U.C. – no cotton. Erase not, so I dare not nettle men in red rose garden – I’m in it.

Stop late men if foreign at nine. Esplanades, simple hotel, bath, gin – king is Edward IX; obese; Ma is no pure mater. Go! Rise, sir; part anon.

I also rehash tests – ‘O’ Level Latin, Italian. S.A.S., so, to track radar. Often nobleman exists alone – not sales reps – I do. Trade ceiling, i.e. final part, lures open if evil trade.

Volga River rises on no steppe. Elsinore has a hamlet – Oh, Bard, row on Avon!

A sacred robot nurses simple hero’s eye; dabs on it a lemon. Gas, iron, Essex often stops, suffers in a mania. Ron fixes several crofts, acer of maple. Hot, I fish; cold, I arise laden; if diary amiss, I know it set no car off. Foe-damned ruby motor, it only rebels.

Ian I swept aside to visit, in a bar of moorside red, Romanis met in a more mossy ale den. Inspired am I, Oswald. A bay bed is nine p on top. No name, niftiness- elder saw it. Oh no! Saw top wet star’s pool – part star, part otter. Refer a baron to idiot, Tony, as I did.

Smart ones use submarine.

Poet, arch-super-artiste, grew artistic. I lost rattle; my amiable, not oh so old, able to hang up, mina, can deliver it, so true. “Ta, matey!” – says so Boston (Mass.) elder I hit.

On file S.A.E. was sent – I wrote poster re fat on side, volume one – loved it, never off it, I was in. Aide mocks a manic; I mock comic, I nap: too bad I had a fit, I too. Bottle ban odd, I go drop mine, ergo trial ceded a fatness, sober if not so, or a test is debased.

A vet is agog – no pet’s in a cask – corgi dog, royal pet, a risk no more.

Lob a rod at a man I meet. Sewer delays pit fires – a bedlam in a dig – iron ore rots it. No devil is a hero – Nimrod.

At a mall a cod is all I get. I bet on Eva, so Tim ate whole eel bait, I pay tip, Eva had a hood sewed. No B.A. gave car to Nero, we were not to rev it and we lost a trail; I’m a free pill, I wrong a man. I erase gap; to help miss it, I fill a set. A gent in ire knocks a cadet.

Animals’ gel on spoon – it is so true to basics – I’d gel; too bad I hide kangaroo baths – I lived as I won raffle, flew as I did go, dash, to my, also too tired now, star comedy: A wan, inept, upset I’m retired, nut; its ilk, nicer. Nettle feels a sore; sad, I did no panic in a pain, am an ill or tired, nude, based item; it is a spot.

Semitone, not a tone, radios emit; no, on tape; elsewhere it’s a tone.

Tail is not on; pots open on foot, even on it, so let oven (on, it is) simmer – a hotpot’s a stupid ham stew.

Loop a loop, animal – cat up in air.

Both sacks I rate by apple hewn in elder’s garden if it rates, I was aware – tasted a core.

Zones or areas, Annie, cap, so twelfth girl, lass, alas, simply (alpha beta) done, Kate. Tadpole won top Oscar, Obadiah, “O” Level axed.

Argon gas did emit no straw, so ozone sure drops argon, oozes up in Ruth’s ample hotel or sits afar off in a bar – of elastic, is it?

I hate cinema; cinema dogs in a mass. Older effusion to old – lost, is it now? Reward: a mood.

All upsets it.

Radar trails an Islamic educer of a riling issue, damages it in Israel. Ceiling is, I say, a plan, a case of one deck. Can knees sag as one Latin image elates, I wonder?

Oboe diverts ultra foe, volatile bald ogre – push to berate; I’d do, ogre. So, p.m., Oct. first, never play organ’s stops – lay or put it up in ward ten.

Final cast like rowing – I sedate play, old as am I, God! Am I! On tacks I ran; I saw rats. A Gemini tramp is May born.

I back colony’s sober omen of lack of lace. Rome, not Paris, a wonder.

Obey retail law – a noose killed oyster. Reflate my ball, a water-filled one. Disabuse no name of emanating issue.

Damsels, I note, vary tastes so cost now desserts. I say no! Try taste more honeyed. A bad nemesis at naff ruse will upset. I, mere Satanist, e.g. rater of a devil – (Oh wrong is a sin!) – I’m no devil’s god, damned.

Animals, if on a mat, sit. Rain, a more vile drop, made us site it in a cottage. Breed deer – bottle fits a llama.

I lay, as I emanate, go to sleep, mad ones on docks – air is hot. Entrap, net, nine men in party raid – all if it is in a crab-pot room, an itemised, under-lit, nullified old log den – I’m sure voles made it rot in knot.

Tubas we see far off lack limit. A cat on still or tall upward paws to no dog is an ample hot-dog, ergo nastier if tastier, eh? We, raw amid a conman, a mama in a mask, corpse et al., err.

Octuple tracks at a son’s eyelash side distressed a tall eye doctor, a tall ace, rigger of a vote: got put in egress; odd, abased, is ebbed, as I am, Amy, asinine lot! Nine lots! Don’t six rams live? Don’t six exist?

Alfred, nuts or fool gigolo, trod never if gold locks all in a flap on a red rose; made nine or ten stops.

I heed never, I’m Daisy, a prod never, I terrorise viler starfish. To me suitors, no lemons, came rowing. Is a sin a mania? Rot!

Sit! I fix a looted amp or delay more, hasten not. A baser if snug stool, wonkier, if not – Alf says – super, a ballet to no devil, is a stool too. Ban it, actor, race to no tune.

May names I wrote wrong (Is no man in it, a long old log?) sit in row, sign irate Goths; I dare drop it. At felon’s eye I peer, fast open – I’m nosey, esteem eyes. All upset, ample hogs resume totting. Is sad nabob tired? Roots don’t evade liver in Alf’s gob.

Deers I held right; oblong, apt enamel or tile rifle on gun spot to get a man – aim is all. I rogate, minister. Feeble gnats, alas late, prosaic, a canine pet is not to consume hot.

Loo, wet, issues old idiot; evading, I sneer, obey a deer, gall a deer, gain alpine dragnet for egg I’d net to ram in a pan I made to help master. Rags I held, arcane poet, arcane poetic error, all odd; I bottle fine panacean lust. I’d nag elks I ride if editor toted a minor. I fog a natural life.

Roses, or level dumb ones – rows in a mown, ample, hewn acre. Wolfsbane made it a garden in May, a garden indeed.

Nine mates, nine tons I must save now on time – editor raps a late man. G.I.s edit also, too. Do over if tests in a task radiate. Rob ran; I, too, fled.

“Omega” – list in alphabet.

A gander, a line of live ducks, irk cubs. A wart, set at a cast on knee, snug as spots.

A poor denim for a janitor, racer, armed aide, solid idler – rabid; I’d elastic in a pot, tons to sew.

Tubes or axes went in a clam, in an oyster. Free booze – lap it all up. Pity, my apple hot, so I’d a root stew. God, a stew! Tip it at feline! Posies, a cat’s altar often, no baron packs. A monk caps dog – I meddle here – hot? Pull its leg! A bee was a hoot, eh?

No, it is opposite. Yaks I rode wore hats, albeit on deity’s orders. Rats age more held in a trap, nip and I know it – set no cage now.

It’s eta; no, it’s a beta – Tsar of Tonga rates isles. Mad Ed is all upset at cider, is Ed? Is a madam too? Snip? I’d snip, spot a fine position, snip nine more cinemas.

Do ogres sell in a mall? Yes, on a barge so rats row tubs.

Wall last canes up or Eros, an imp, lives to irk, rasp or dam all tides sent. I won’t – I was no Roman – even I saw tired row – a sore. He lives on. “No!” we yell.

Up, now! Wards are in nurses’ sole care. I, peer, fed, am too fat? Oh, not I, test no dined ruby ale; dote not on salad it’s in – I am sad.

Locks I rifle so troops atone re war. Only rebel or a crofter animates so cottage beheld arcades, so trees are sold, abased. I redo, rehang, I err – a wasted act; nests I’d – as an owl – laid. A boot’s raw foot, even if a foot to master, germs (ah!) can evil do.

Pan is tune-pipe – so hot notes, paths up to honeydew.

Odd locks, a maddened (I was aware) macaw on top, spot no seen knots, rifts or fan, I saw. Are maces a baton, madam? Oodles, madam? Rare laptops are too late – got too lit up.

Nits rub – snip now, I’ll abate, not snip, nits I held.

Nubile Danish tomboys I led to old loser as no melons I held; no fish to my name. Nod lower, do I dare? No, one nods a hairy snipe. (Edit: one hairy snipe, eh?) See silliness, else we’ll ask cornish to obey deity’s or god’s item. I, God, damn it! I was in it! To Hades, acne trap, sad loser! As warts pop, a dosser I – we – vile rat, sack! Same row, oh woe! Macaroni, rats, as a hoot, tie. I vomit on rats.";
return '$system> KERNEL ERROR (DOES. NOT. EXCIST)'
}

:)


Questo batte questo ?
Joe Z.

1
@JoeZ. In realtà lo fa;) Il mio ha un conteggio parole di 24.122!
C1D,

2
Eccezionale! Signore, tu vinci 2 internet e 5 furetti di metallo che yodel :)
aditsu il

4

Ruby - La forza bruta (ottimizzata e monkeymized!)

Trovo che il modo migliore per farlo sia attraverso il noto Monkey Algorithm, probabilmente lo troverai in BOOST. Hanno sempre avuto il modo di farti parlare ...

def palindrome?(in)#IMPORTANT
  if in.reverse == in
    return true
  else
    return false
end

def getMonkeys(in)#don't forget to interface with C in case of
  MaxMonkeys = 0
  MonkeyTalk = ""
  MonkeySpeed = in.length
  (0..MonkeySpeed).each do |monkeyA|
    (monkeyA..MonkeySpeed).each do |monkeyB|#optimized!
      if palindrome?(in[monkeyA..monkeyB]) do
        if in[monkeyA..monkeyB].length > MaxMonkeys do
          MonkeyTalk = in[monkeyA..monkeyB]
        end
      end
    end
  end
  MonkeyTalk
end

Questo è estremamente inefficiente, ma piuttosto carino e rubino se si rinomina tutto con i loro nomi originali: MaxMonkeys = len; MonkeyTalk = risultato, MonkeySpeed ​​= strlen; scimmia A: a; scimmia B: b; getMonkeys: getMaxPalindrome.
Questo non ha alcun valore per l'OP e rischia che decida di interfacciarsi effettivamente con C, e sappiamo tutti come finisce ...


4

Python 2.7

Mi rifiuto di utilizzare le funzioni standard, in quanto inefficienti. Tutti sanno che il modo migliore per cercare una lunghezza è avere una tabella a cui fare riferimento, quindi creo una tabella di tutti i possibili palindromi e li ordina usando un bogosort pitonico, ma per migliorare l'efficienza, rimuovo prima i duplicati . A quel punto, computo tutti gli elementi che sono palindromi e li ordina per lunghezza. È quindi possibile semplicemente prendere l'ultima lunghezza dell'elenco, che ha una ricerca O (n) ripetendo l'elenco.

Codice:

from itertools import chain, combinations
from random import *
stringToTest = "abba"

#Don't forget to reference code taken from stackoverflow. (http://stackoverflow.com/questions/464864/python-code-to-pick-out-all-possible-combinations-from-a-list)
def FindAllSubsetsOfAString(StringToFindASubsetOf):
  return chain(*map(lambda x: combinations(StringToFindASubsetOf, x), range(0, len(StringToFindASubsetOf)+1)))

listOfPermutations = []

#get the length of the string we are testing, as the python function is not portable across platforms
lengthOfStringToCheck = 0
for currentCharacterInString in stringToTest:
    lengthOfStringToCheck = lengthOfStringToCheck + 1
lengthOfStringToCheckMinusOne = lengthOfStringToCheck - 1
#Always iterate backwards, it is more efficient for  cache hits and misses
for stringBeginningIndex in range(lengthOfStringToCheck, 0, -1):
    listOfPermutations.append(stringToTest[stringBeginningIndex:lengthOfStringToCheckMinusOne])

#To save from errors, we must not operate directly on the list we have, that would be inefficient. We must copy the original list manually.
# The built in functions again aren't portable, so we must do this manually, with a deep copy.
OtherListOfPermutations = []
for CurrentItemInOriginalList in listOfPermutations:
    TemporaryListItem = []
    for CurrentIndexInCurrentItemInOriginalList in CurrentItemInOriginalList:
        TemporaryListItem.append(CurrentIndexInCurrentItemInOriginalList)
    OtherListOfPermutations.append(''.join(TemporaryListItem))

#Get all of the possible strings into the OtherListOfPermutations List.
# Use Generators, and itertools. It's more efficient and more pythonic
for OriginalString in listOfPermutations:
    for CurrentPermutationInCurrentString in FindAllSubsetsOfAString(OriginalString):
      OtherListOfPermutations.append(''.join(list(CurrentPermutationInCurrentString)))

#Sort the list
ListOfStringsSortedByLength = OtherListOfPermutations
while not all(len(ListOfStringsSortedByLength[i]) <= len(ListOfStringsSortedByLength[i+1]) for i in xrange(len(ListOfStringsSortedByLength)-1)):
    shuffle(ListOfStringsSortedByLength)

#Remove all of the duplicates in the sorted list
ListOfStringsSortedByLengthWithoutDuplicates = []
for CurrentStringWorkingWith in OtherListOfPermutations:
    HaveFoundStringInList = False
    for CurrentTemporaryString in OtherListOfPermutations:
        if CurrentStringWorkingWith == CurrentTemporaryString:
            HaveFoundStringInList = True
            if(HaveFoundStringInList == True):
                ListOfStringsSortedByLengthWithoutDuplicates.append(CurrentStringWorkingWith)

#Use the ListOfStringsSortedByLengthWithoutDuplicates and check if any of the strings are palindromes
ListOfPotentialPalindromes = []
for TemporaryStringToUseForPalindromes in ListOfStringsSortedByLengthWithoutDuplicates:
    lengthOfStringToCheck = 0
    for currentCharacterInString in TemporaryStringToUseForPalindromes:
        lengthOfStringToCheck = lengthOfStringToCheck + 1
    if lengthOfStringToCheck != 0:
        TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1]
        if TemporaryStringToUseForPalindromesReversed == TemporaryStringToUseForPalindromes:
            ListOfPotentialPalindromes.append(TemporaryStringToUseForPalindromes)

#Remove any duplicates that might have snuck in there
ListOfPotentialPalindromesWithoutDuplicates = []
for CurrentPotentialPalindrome in ListOfPotentialPalindromes:
    HaveFoundStringInList = False
    for CurrentTemporaryPalindrome in ListOfPotentialPalindromes:
        if CurrentPotentialPalindrome == CurrentTemporaryPalindrome:
            HaveFoundStringInList = True
            if(HaveFoundStringInList == True):
                ListOfPotentialPalindromesWithoutDuplicates.append(CurrentStringWorkingWith)

lengthOfPalindromes = []

for CurrentPossiblePalindrome in ListOfPotentialPalindromesWithoutDuplicates:
    CurrentPossiblePalindromeLength = 0
    for currentCharacterInPossiblePalindrome in CurrentPossiblePalindrome:
        CurrentPossiblePalindromeLength = CurrentPossiblePalindromeLength + 1
    lengthOfPalindromes.append(CurrentPossiblePalindromeLength)


while not all(lengthOfPalindromes[i] <= lengthOfPalindromes[i+1] for i in xrange(len(lengthOfPalindromes)-1)):
    shuffle(lengthOfPalindromes)

#find the last value in the list:
currentValue = 0
for currentPalindromeLength in lengthOfPalindromes:
    currentValue = currentPalindromeLength

print currentValue

Nota

Non adatto a stringhe più lunghe di 4 caratteri. "Abba" va bene, ma sono andato a comprare il caffè e ho cucinato il pranzo prima che facesse l'abcba

Problemi:

Denominazione variabile insana (e anche incoerente)
Scelta dell'algoritmo Ludicrous (Calcola tutte le possibili permutazioni di ogni sottostringa della stringa data, controlla se sono palindromi, ordinale per lunghezza e cerca l'ultimo valore)
In realtà contiene la soluzione al problema

    TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1] 

Algoritmo di ordinamento stupido (bogosort) e un metodo nutjob per garantire che l'elenco sia ordinato.

Inoltre, c'è un errore di rientro nel controllo dei duplicati che in realtà non fa nulla, è solo una perdita di tempo.


4

C

Trovare palindromi è un'operazione difficile PNP *, quindi deve essere fatto con un codice altamente ottimizzato. Ecco cinque trucchi per l'ottimizzazione che ti aiuteranno a trovare la soluzione più velocemente.

  1. Inizia con la lingua giusta. Come tutti sanno, "C" è la più veloce.
  2. Usa un algoritmo veloce. BoyerMoore è il detentore del record mondiale per la ricerca di stringhe, quindi lo useremo. Cercheremo anche prima le sottostringhe più lunghe in modo da avere le migliori possibilità di trovare una corrispondenza lunga.
  3. Conosci il tuo processore. I computer moderni sono orribilmente lenti ai rami del if this else thatmodulo. (Mentre vai avanti nella tua carriera, dovresti padroneggiare Branch Prediction se vuoi essere un vero ninja di codice.) Questo codice evita il ifproblema di ramificazione usando forinvece le istruzioni, che ti danno 3 istruzioni al prezzo di uno.
  4. Presta attenzione al "Big-O". Questo algoritmo non utilizza parentesi graffe all'interno dei corpi delle funzioni, evitando così eventuali cicli nidificati. Quindi il runtime deve essere O (N).
  5. Non dimenticare le micro-ottimizzazioni. Usando la nota tecnica di rimozione di tutti gli spazi bianchi tra le istruzioni, sono stato in grado di ridurre il carico di lavoro del compilatore e ottenere un ulteriore aumento del 10%.

Ma non lesinare sui nomi delle variabili, la leggibilità è importante.

* Palindrome-non Palindrome

#define OFFSET 0XFF
#define ln(s) strlen(s) //macro to avoid runtime overhead

char* boyermore(char* needle, char* haystack){
  int i,k[OFFSET];
  for(i=0;i<OFFSET;i++)k[i]=ln(haystack);
  for(i=1;i<ln(haystack);i++)k[haystack[i]]=ln(haystack)-i;
  for(i=2;ln(needle)>=ln(haystack);needle+=k[needle[ln(haystack)]])
  for(i=ln(haystack)-1;needle[i]==haystack[i];i--)if(!i)return needle;
  return 0xFF-OFFSET;
}

char* reverse(char*src,char*dest,int loops){
  for(*(src+loops)=0;loops;src[--loops]=*(dest++));
  return src;
}

#define imax(a,b) ((a>b)?a:(b))
int main(int i, char*in[2]){
  char* is,*begin,*maybe,max=-1;
  char* end=in[-max],*start=end+ln(end);
  for(begin=malloc(start-end);--start>end;)
  for(i=start-end;i>0;i--)
  for(maybe=reverse(begin,start-i,i);boyermore(in[1],maybe);*maybe=1)
  for(;i>max;max=imax(i,max))is=start-i;
  for(maybe="found";max>0;max=-max) puts(reverse(begin,is,max));
}  

Oltre all'evidente trolling nel commento, ci sono molte altre questioni. L'algoritmo di ricerca è un'implementazione valida di Boyer-Moore-Horspool, ma non memorizza mai le lunghezze delle stringhe, invece chiama strlen qualcosa come N * M volte, rendendolo molto più lento di una semplice ricerca. "Cercare prima la stringa più lunga" è vero, ma dopo ciò non cerca per ordine di lunghezza, quindi un'uscita anticipata darebbe una risposta errata, se fosse implementata. Ma non lo è, quindi cerca tutti gli N! possibilità comunque. E quasi tutti i nomi dei parametri (ago / pagliaio; src / dest) sono invertiti rispetto ai loro significati standard.


3

Questo è quello che ho finora in VB6:

Public Function strLongestPalindrome(ByVal strInput as String) as String

    strLongestPalindrome = ""
    Dim a as Integer
    Dim b as Integer

    For a = 1 To Len(strInput)
        For b = 1 to a
            Dim c as Integer
            Dim d as Integer
            c = a
            d = b
            Do
                If Mid$(strInput, c, 1) = Mid$(strInput, d, 1) Then
                    c = c + 1
                    d = d - 1
                    If c >= d Then
                        strPalindrome = Mid$(strInput, a, b-a+1)
                        If Len(strLongestPalindrome) < Len(strPalindrome) Then
                            strLongestPalindrome = strPalindrome
                        End If
                        Exit Do
                    End If
                Else
                    Exit Do
                End If
            Loop
        Next
    Next

End Function

Ma non penso che funzioni e penso di poterlo migliorare.


2
Questa dovrebbe essere una risposta all'ultimo posto, senza traina, anche se per le persone che non hanno mai programmato VB6 prima, potresti non sapere che non avrebbe dovuto trollare.
Joe Z.

3

Ecco una soluzione Java per te:

public String findLongestPalindrome(String s){
   if(s.equals("the longest palindrome")){
      return "the longest palindrome";
   }else{
      throw new IllegalArgumentException();
   }
}

3
Ma "il palindromo più lungo" non è nemmeno un palindromo ...
Joe Z.

2

AutoHotkey

;msgbox % longest_palindrome_in_string("racecar abcdedcba alkdf")

longest_palindrome_in_string(str){
l := Strlen(str) , max := 1
loop % l
{
    p := A_index
    loop % l-p
    {
        s := Substr(str, p, A_index+1) , k := ""
        loop, parse, s
            k := A_LoopField k
        if k = %s%
            if (sl:=Strlen(s)) > max
                out := s , max := sl
    }
}
return out
}

La funzione restituisce anche spazi in quanto fanno parte di una sequenza palindromo in stringa. Quindi ritorna sopra <space>abcdedcba<space>.


1

Poliglotta

Questo è il trolling perché chiede di "trovare il palindromo più lungo in una stringa", quindi trova il palindromo più lungo in "una stringa"

String palindrome(){
    return null; //There are no palindromes in "a string"
}

Questo non restituirà nulla quando inserirò "abcba" ... sei sicuro che funzioni?
Joe Z.

@JoeZ. Ho dimenticato di dire perché è stato il trolling
scrblnrd3,

5
Lo capisco, ma come ho detto a un sacco di altre persone, è troppo ovvio. Questo tipo di gioco di parole non è un buon troll.
Joe Z.

1
Ci sono diversi palindromi (lunghi un carattere) in "una stringa". Il codice sopra non è corretto.
Ben,

2
@Ben Ci sono 9 palindromi in "una stringa" - "", "a", "", "s", "t", "r", "i", "n", "g". La domanda richiede chiaramente il palindromo più lungo (come al singolare). Dal momento che, come la vedo io, c'è un pareggio a 8 vie, la risposta è indefinita. Pertanto null è un valore di ritorno appropriato.
emory,


1

Scorrere tutti i caratteri della stringa. Quindi controlla i personaggi prima e dopo quel personaggio. Quindi i personaggi due prima e due dopo quel personaggio. Continua a ripetere fino ad arrivare a personaggi che non sono gli stessi. Ciò ti consentirà di identificare la lunghezza di ciascun palindromo nella parola. Tuttavia, questo metodo funziona solo con palindromi di lunghezza dispari. Per verificare la presenza di palindromi di lunghezza pari, controlla il carattere in posizione i e i-1, quindi i + 1 e i-2, quindi i + 2 e i-3, ecc. Spero che questo aiuti !!


1

La risposta ovvia è confrontare la stringa con il suo inverso e calcolare la sequenza comune più lunga.

Il seguente programma Perl fa proprio questo. Potrebbe essere necessario scaricare il modulo Acme :: DonMartin, di solito non è installato per impostazione predefinita.

use Acme::DonMartin;

sklush klikrunk skroik hee doodle shompah sproingdoink varoom hushle
fwiskitty twop pok zich frack gleep shloop zgluk zlitz faroolana deebe
fump kachoo zock fween boong pitooie oggock gahoff glip fwask padap fut
ooga chukkunk shkaloink kazash splosh sklizzorch fak ahh doom twop
beedoop gak wee fitzrower shkwitz shklik fweep spla gring glink splurp
thomp fwoof thoom kipf ging krunch blib ga kikatik bash dap thork huff
katoonk fak shik stoof dimpah skapasch skronch kachunka arargh sprat
gonk yip inkle blink fagwoosh fowm splapple blamp doomp ploom gishklork
shwik fomp plortch skroik gashplutzga plortch da goyng shtork borfft
zwot ping puffa trump thlip dig blonk thhhut splatch doonk sklizzorch
sprazot pwof slapth spashle kreek eck kik dit foing glukkle glikity
spazoosh plapf gashklitz mabbit boong sklortch swipadda sknikle phelop
skloshitty zat dokka splazitch tika zikka fling shooka glangadang
brrrapp fwizz gasploosh doop swish dikka splesh shooka blut galink
yeech caw tink sklitch shash tffp skrink poffisss oont spazoosh blort
aarh ting ho shpikkle shompah tood shkalink gloople skloshitty

Puoi trovare il modulo qui: metacpan.org/pod/Acme::DonMartin
dland

1

Lua / Python

Lua è un linguaggio molto veloce (di cui hai bisogno, perché ci sono molte sottostringhe da controllare!), Ma Python è meglio con la gestione delle stringhe. Quindi perché non usare entrambi?

Perché ho sentito che è bello avere variabili locali, ne ho una. Inoltre, ho separato le chiamate di funzione dai loro argomenti, perché troppi argomenti rendono le espressioni ingombra e illeggibili.

Inoltre, penso che questo funzionerà con tutte le stringhe che vuoi provare, probabilmente non ci saranno problemi con input strani di sorta.

function is_palindrome()
    if os.execute("python -c 'exit(\"" .. is_palindrome_argument .. "\"==\"" .. is_palindrome_argument .. "\"[::-1])'") == true then
        return false
    else
        return true
    end
end

function longest_palindrome()
    local longest -- very important to use local variables
    for length = 1, #longest_palindrome_argument do
        for start_index = 1, #longest_palindrome_argument - length + 1 do
            is_palindrome_argument = string.sub(longest_palindrome_argument, start_index, start_index + length - 1)
            if is_palindrome() then
                longest = is_palindrome_argument
            end
        end
    end
    return longest
end

longest_palindrome_argument = "foo racecar"
print(longest_palindrome())

(A proposito, non crederai a quanto tempo mi ci è voluto per farlo funzionare.)


1

Python one-liner:

s = "here goes your string"
print max(p for p in [s.lower()[j:i] for i in range(len(s) + 1) for j in range(len(s) + 1) if ' ' not in s[j:i] and s[j:i] != '' and len(s[j:i]) > 2] if p == p[::-1])

1

Python - 126 personaggi

Ecco il mio andare a questo:

k=[]
for i in range(len(p)):
 for j in range(i,len(p)):
  if p[i:j]==p[j:i:-1]:
   k.append(p[i:j+1])
k.sort(key=len)
k=k[-1]

Questo funziona in Python 2.xe 3.x, credo. La variabile k contiene la risposta.

EDIT: ho dimenticato di dire, la variabile p dovrebbe contenere la stringa per verificare la presenza di palindromi.

Questa è un'implementazione legittima, quindi funzionerà per qualsiasi stringa.


A proposito, questo è il mio primo codice golf! Woohoo! : P
cjfaure,

Questo in realtà ha un tag di troll del codice ed è quindi un concorso di troll del codice.
Pierre Arlaud,

1
@ArlaudPierre Yup, capito che dopo che ho pubblicato. Sospiro. xD
cjfaure,

Intendevo quindi un concorso di popolarità *. Va bene non importa xD
Pierre Arlaud

0

Giava

Ovviamente se aStringè esso stesso un palindromo, allora aStringè il palindromo più lungo all'interno aString. Si può dire che funziona con l'affermazione di asserzione. Non pensare troppo alla prima riga del codice eseguibile. Questo è solo un piatto standard di Java.

public CharSequence findLongestPalindromeInside(String aString)
{
       aString=new StringBuilder(aString).append(new StringBuilder(aString).reverse());
       assert isPalindrome(aString);
       return aString;
}

public boolean isPalindrome(CharSequence charSequence)
{
      return charSequence.toString().equals(new StringBuilder(charSequence).reverse().toString());
}

0

Lingua di Game Maker

var str,length,i,out,char;
str=argument0
out=""
length=string_length(argument0)
for(i=0;i<string_length(argument0);i+=1){
 char=string_char_at(str,length-i)
 out+=char
}
return argument0+out;

Potrebbe voler descrivere cosa sta succedendo?
Joe Z.

0

Fortran

Le stringhe sono troppo difficili da lavorare in Fortran, quindi ho deciso di usarle iacharper convertirle tutte in numeri interi:

program long_palindrome
   implicit none
   character(len=100) :: string
   integer, dimension(100) :: fwd,rev
   integer :: i,j,fs,fe,rs,re

   print *,"enter string with palindrome hidden in it (max 100 characters)"
   read(*,*) string
   fwd = 0

! convert characters to ASCII integers
   do i=1,len(trim(string))
      fwd(i) = iachar(string(i:i))
   enddo

! reverse whole array
   j=len(trim(string))
   do i=1,len(trim(string))
      rev(i) = fwd(j)
      j = j-1
   enddo

! match strings of fwd and rev
   rs = 1; re = len(trim(string))
   fs = 1; fe = len(trim(string))

! test to see if whole thing is a palindrome
   if(all(fwd(fs:fe)==rev(rs:re))) then
      print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
      stop
   endif

! nope? oh well, guess we have to loop through and find it
   fs = 0
   do
      fs = fs+ 1
      do fe = len(trim(string)),fs+1,-1
         do rs=1,fs
            re = fe-rs+1
            if(all(fwd(fs:fe)==rev(rs:re))) then
               print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
               stop
            endif
         enddo
      enddo
      if(fs==len(trim(string))-1) exit
   enddo

   print *,"hmm, doesn't look like there was a palindrome of length > 1..."
end program long_palindrome

Non funziona esattamente. Data la stringa aabbaac, dice che è la più lunga aa, ma data la stringa acasdabbbaabb, dice che è la più lunga abbba. Abbastanza vicino.


In realtà, bbaabbè più lungo nel secondo.
Joe Z.

@JoeZ .: Come ho detto, abbastanza vicino. : D
Kyle Kanos,

0

Non puoi competere nel mercato di oggi semplicemente facendo quello che ti viene chiesto. Questo codice troverà anche il palindromo più corto e non distingue tra maiuscole e minuscole:

def flp(s):
    lp = 'the longest palindrome'
    sp = 'the shortest palindrome'
    return lp if lp in s.lower() else sp if sp in s.lower() else ''

>>> flp('xxxxthe longest palindromexxxx')
'the longest palindrome'
>>> flp('xxxxthe shortest palindromexxxx')
'the shortest palindrome'

0

Lua

function findPalendromes(str)
    str=str.." "
    ret_s=""
    for s in str:gmatch"(%w+)[ ]" do
        if s==s:reverse() and s:len()>ret_s:len() then ret_s=s end
    end
    return ret_s
end

0

Implementazione Python più efficiente che supera tutti gli altri sforzi:

def find_the_longest_palindrome(s):
    print "'the longest palindrome' found at : " + str(s.find("the longest palindrome"))

Gli appunti:

Questo troverà sempre "il palindromo più lungo"

Fa distinzione tra maiuscole e minuscole.

Con alcune modifiche può anche essere fatto per trovare altre stringhe. Tuttavia, dovrai creare una classe, aggiungere un metodo appropriato e quindi sottoclassarlo per ogni stringa da trovare.

Questa funzione può essere migliorata eseguendo il porting su FORTRAN 77 o inserendo un codice nel codice macchina Intel 8008.


0

Questa è la mia prima risposta alla traina del codice. Non è un troll particolarmente brutale, mi ha solo colpito come un modo sciocco per rispondere alla domanda

private static String findLongestPalindrome(String input) {
    String longest = null;
    for (int i = 1; i <= input.length(); i++) {
        Matcher m = pattern(i).matcher(input);
        if (m.find()) {
            longest = m.group();
        }
    }
    return longest;
}

private static Pattern pattern(int len) {
    int size = len / 2;
    StringBuilder sb = new StringBuilder();
    for (int i = 0; i < size; i++) {
        sb.append("(.)");
    }

    if (len != size * 2) {
        sb.append(".");
    }

    for (int i = size; i > 0; i--) {
        sb.append("\\").append(i);
    }
    return Pattern.compile(sb.toString());
}

I troll sono:

  • Creare manualmente lo stesso modello ogni volta
  • Usando costose backreferenze per trovare palindromi
  • Iterando da 1 a input.length () (facendolo al contrario, si sarebbe sicuri che la prima corrispondenza trovata fosse la più lunga. Farlo nel modo sopra è stupido)

0

Python 3

from itertools import takewhile

def common_part(s1, s2):
    return sum(takewhile(bool, (a==b for a, b in zip(s1, s2)))) 

def palindromes(s):
    for i in range(1, 2*len(s)):
        m = i//2; n = i - m
        common = common_part(s[n-1::-1], s[m:])
        p = s[n-common:m+common]
        if p: yield p

string = input('> ')

print('Longest palindrome is', repr(max(palindromes(string), key=len)))

Programma molto efficiente. Cerca i palindromi lunghi con il centro in posizioni sequenziali (sul carattere e tra) e seleziona il più lungo

Utilizzando il nostro sito, riconosci di aver letto e compreso le nostre Informativa sui cookie e Informativa sulla privacy.
Licensed under cc by-sa 3.0 with attribution required.